| ctgttgaaagtatacaacatgtaagtctgttcatcttttcgtatcaatcg |
| tatcgcgctaaaaattatggtagttactaacgtagtggtatacataatgt |
| caactgccgcatataatggatttgcctagtgcttgaacggaggtgcaatg |
| atgtcaaaacgcctgaattaattggtaatactatagcggtgcggacccta |
| ttaagtattaggtgcgtaacctctcagggttgccgcccggttttatcctt |
| tgtgtaatagcctttttagagtcgaccgttcctcgtcacgcgtaaaattt |
| gtatgaatcctcgttggtttgtgggacgaccctttgtctatagtataaca |
| ccccggcaagttctaatcggctgtcagctactactatcctgggcgaacag |
| tgaaggcgtcgcgagtcttatgggtcaaatggccgaataaaacaatctta |
| tgagaggtctgtagacgacgattcgctgtcttatttgcccgccaagtaag |





But don't forget:
| Factor | Sequence Motif | Comments |
| c-Myc and Max | CACGTG | c-Myc first identified as retroviral oncogene; Max specifically associates with c-Myc in cells |
| c-Fos and c-Jun | TGA[CG]T[CA]A | both first identified as retroviral oncogenes; associate in cells, also known as the factor AP-1 |
| CREB | TGACG[CT][CA][GA] | binds to the cAMP response element; family of at least 10 factors resulting from different genes or alternative splicing; can form dimers with c-Jun |
| c-ErbA; also TR (thyroid hormone receptor) | GTGTCAAAGGTCA | first identified as retroviral oncogene; member of the steroid/thyroid hormone receptor superfamily; binds thyroid hormone |
| c-Ets | [GC][AC]GGA[AT]G[TC] | first identified as retroviral oncogene; predominates in B- and T-cells |
| GATA | [TA]GATA | family of erythroid cell-specific factors, GATA-1 to -6 |
| c-Myb | [TC]AAC[GT]G | first identified as retroviral oncogene; hematopoietic cell-specific factor |
upstream regions:
| ctgttgaaagtatacaacatgtaagtctgttcatcttttcgtatcaatcg |
| tatcgcgctaaaaattatggtagttactaacgtagtggtatacataatgt |
| caactgccgcatataatggatttgcctagtgcttgaacggaggtgcaatg |
| atgtcaaaacgcctgaattaattggtaatactatagcggtgcggacccta |
| ttaagtattaggtgcgtaacctctcagggttgccgcccggttttatcctt |
| tgtgtaatagcctttttagagtcgaccgttcctcgtcacgcgtaaaattt |
| gtatgaatcctcgttggtttgtgggacgaccctttgtctatagtataaca |
| ccccggcaagttctaatcggctgtcagctactactatcctgggcgaacag |
| tgaaggcgtcgcgagtcttatgggtcaaatggccgaataaaacaatctta |
| tgagaggtctgtagacgacgattcgctgtcttatttgcccgccaagtaag |
and a motif with logo

| Collect the stats into a profile matrix
gtataa48 |
| --- | gtatac | --- | |||||||||
| --- | atataa | --- | |||||||||
| --- | gaataa | --- | |||||||||
| --- | gtctta | --- |
Find substrings with the `best' profile
Best profile = best CONSENSUS

|
|
|
|